Your browser doesn't support javascript.
Show: 20 | 50 | 100
Results 1 - 8 de 8
Filter
1.
Mol Ther ; 31(4): 1136-1158, 2023 04 05.
Article in English | MEDLINE | ID: covidwho-2246827

ABSTRACT

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.


Subject(s)
COVID-19 , Viral Vaccines , Humans , SARS-CoV-2/genetics , Signal Transduction , RNA, Messenger/genetics
2.
Vaccines (Basel) ; 10(6)2022 May 27.
Article in English | MEDLINE | ID: covidwho-1869864

ABSTRACT

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.

4.
Cell Biosci ; 11(1): 168, 2021 Aug 30.
Article in English | MEDLINE | ID: covidwho-1379800

ABSTRACT

BACKGROUND: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection. RESULTS: We demonstrated that green tea beverage (GTB) or its major ingredient, epigallocatechin gallate (EGCG), were highly effective in inhibiting infection of live SARS-CoV-2 and human coronavirus (HCoV OC43). In addition, infection of the pseudoviruses with spikes of the new variants (UK-B.1.1.7, SA-B.1.351, and CA-B.1.429) was efficiently blocked by GTB or EGCG. Among the 4 active green tea catechins at noncytotoxic doses, EGCG was the most potent in the action against the viruses. The highest inhibitory activity was observed when the viruses or the cells were pre-incubated with EGCG prior to the infection. Mechanistic studies revealed that EGCG blocked infection at the entry step through interfering with the engagement of the receptor binding domain (RBD) of the viral spikes to angiotensin-converting enzyme 2 (ACE2) receptor of the host cells. CONCLUSIONS: These data support further clinical evaluation and development of EGCG as a novel, safe, and cost-effective natural product for prevention/treatment of SARS-CoV-2 transmission and infection.

5.
Biology (Basel) ; 10(7)2021 Jul 13.
Article in English | MEDLINE | ID: covidwho-1323102

ABSTRACT

The Toll-like receptor (TLR) 7 is a viral sensor for detecting single-stranded ribonucleic acid (ssRNA), the activation of which can induce intracellular innate immunity against viral infections. Imiquimod, a synthetic ligand for TLR7, has been successfully used for the topical treatment of genital/perianal warts in immunocompetent individuals. We studied the effect of imiquimod on the human immunodeficiency virus (HIV) infection of primary human macrophages and demonstrated that the treatment of cells with imiquimod effectively inhibited infection with multiple strains (Bal, YU2, and Jago) of HIV. This anti-HIV activity of imiquimod was the most potent when macrophages were treated prior to infection. Infection of macrophages with pseudotyped HIV NL4-3-ΔEnv-eGFP-Bal showed that imiquimod could block the viral entry. Further mechanistic studies revealed that while imiquimod had little effect on the interferons (IFNs) expression, its treatment of macrophages resulted in the increased production of the CC chemokines (human macrophage inflammatory protein-1 alpha (MIP-1α), MIP-1ß, and upon activation regulated normal T cells expressed and secreted (RANTES)), the natural ligands of HIV entry co-receptor CCR5, and decreased the expression of CD4 and CCR5. The addition of the antibodies against the CC chemokines to macrophage cultures could block imiquimod-mediated HIV inhibition. These findings provide experimental evidence to support the notion that TLR7 participates in the intracellular immunity against HIV in macrophages, suggesting the further clinical evaluation of imiquimod for its additional benefit of treating genital/perianal warts in people infected with HIV.

6.
Front Cell Neurosci ; 15: 682272, 2021.
Article in English | MEDLINE | ID: covidwho-1295666

ABSTRACT

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.

7.
J Med Virol ; 93(4): 1983-1998, 2021 04.
Article in English | MEDLINE | ID: covidwho-1217384

ABSTRACT

Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 (Neuro-SARS2). Accumulated robust evidence indicates that Neuro-SARS2 may play an important role in aggravating the disease severity and mortality. Understanding the neuropathogenesis and cellular mechanisms underlying Neuro-SARS2 is crucial for both basic research and clinical practice to establish effective strategies for early detection/diagnosis, prevention, and treatment. In this review, we comprehensively examine current evidence of SARS-CoV-2 infection in various neural cells including neurons, microglia/macrophages, astrocytes, pericytes/endothelial cells, ependymocytes/choroid epithelial cells, and neural stem/progenitor cells. Although significant progress has been made in studying Neuro-SARS2, much remains to be learned about the neuroinvasive routes (transneuronal and hematogenous) of the virus and the cellular/molecular mechanisms underlying the development/progression of this disease. Future and ongoing studies require the establishment of more clinically relevant and suitable neural cell models using human induced pluripotent stem cells, brain organoids, and postmortem specimens.


Subject(s)
Brain/virology , COVID-19/pathology , Nervous System Diseases/virology , Neuroglia/virology , Neurons/virology , Animals , Brain/pathology , Cell Line , Humans , Nervous System Diseases/pathology , Neural Stem Cells , Neuroglia/pathology , Neurons/pathology
SELECTION OF CITATIONS
SEARCH DETAIL